• first, create clusters of overlapping RNA prediction of the same family. We consider that two overlapping putative RNAs must share at least 10 nucleotides and occur on the same strand. For the family, we use an equivalent family name table, that gives a generic name for a family and the equivalent name given by all gene finders.
  
• then, for each cluster, create a new putative RNA, obtained by combination of existing predictions.
  • for tRNA and rRNAs, we privilege the prediction given by specific gene finders, because these gene finders appear to give better results.
  • for unknown families, a special treatment is defined because corresponding gene finders rely on so different approaches (based on sequence comparison or sequence characteristics)
  • for other family names, a general default rule is defined

• Default combine rule of a cluster:
  One combined RNA defined by the generic family of the cluster, the maximal positions, the common strand.

• IF cluster of tRNA
  THEN IF no tRNAscan-SE predictions 
      THEN default combine rule
  
      ELSE IF one tRNAscan-SE prediction 
          THEN combined RNA has the tRNAscan-SE family name, 
               the min and max positions of the cluster for start 
               and end positions, and the common strand
  
          ELSE (several tRNAscan-SE predictions) do nothing 
               (do not combine the cluster)
  

• IF cluster of 5s_rRNA, 8s_rRNA, 16s_rRNA,
                    18s_rRNA, 23s_rRNA or 28s_rRNA
  THEN IF no RNAmmer predictions 
      THEN default combine rule
  
      ELSE IF one RNAmmer prediction 
          THEN combined RNA has the RNAmmer family name, 
               the min and max positions of the cluster for start 
               and end positions, and the common strand
  
          ELSE (several RNAmmer predictions) do nothing 
               (do not combine the cluster)
  

• IF cluster of unknown
      THEN first, remove user added predictions
           second, cluster the remaining predictions considering their 
           gene finder set (homology search, conservation anlysis, ab initio)
           and apply the default combine rule on each subset.
  	    

• ID: putative RNA identifier.
  Allowed characters: a-z, A-Z, 0-9, -, _, .
  Maximum length: 6 characters
• Seq name: name of the query sequence (as provided originally).
  Allowed characters: a-z, A-Z, 0-9, -, _, .
  Maximum length: 40 characters
• Family: family of the putative RNA family, 'unknown' when not known.
  Allowed characters: a-z, A-Z, 0-9, _, ., ',', '
  Maximum length: 20
• Start: start position of the putative RNA on the query sequence.
  Allowed characters: numeric
  Maximum length: -
  Constraints: must be < end
• End: end position of the putative RNA on the query sequence.
  Allowed characters: numeric
  Maximum length: -
  Constraints: must be > begin
• Size: length of the putative RNA, in nucleotides.
  Allowed characters: numeric
  Maximum length: -
  
• Strand: '+' corresponds to the same strand as the query sequence, '-' to the opposite strand and '.' stands for unknown strand.
  Allowed characters: +, -, .
  Maximum length: 1
  
• Species: species of the putative RNA sequence (as provided originally).
  Allowed characters: a-z, A-Z, 0-9, -, _, .
  Maximum length: 20
  
• Domain: domain (Archea/Bacteria/Eukaryote) of the putative RNA (as provided originally).
• Replicon: putative RNA sequence replicon (as provided by you).
  Allowed characters: a-z, A-Z, 0-9, -, _, .
  Maximum length: 20
  
• Software: name of the gene finder used to identify the putative RNA.
  Allowed characters: a-z, A-Z, 0-9, -, :, .
  Maximum length: ???
  
• Align.: number of alignments in which the putative RNA is involved
• Run: run identifier, of the form r01, r02, and so on.

• rename family: change the family name. The new name will be assigned to all selected RNAs. It must be made up of upper and lower case letters, figures and '_' '.' '-' characters. Name length must be between 1 and 20 characters.
• split into 2 families: put selected predictions in two families. You have to specify two family names and then assign each selected putative RNAs to one of these two families. The names must be made up of upper and lower case letters, figures and '_' '.' '-' characters. Name length must be between 1 and 20 characters.
• add a new putative RNA manually: add a new putative RNA to the list of results. For that, you have to describe all features attached to the RNA: ID, family name, genomic sequence name, start position, end position, strand and optionnaly a secondary structure. The genomic sequence has to be chosen in the list of previously loaded sequences. See the section Editing a prediction for futher information concerning the other fields. Click on the save button to store the description. The new putative RNA is inserted in the pool of putative RNAs, and the Explore page is automatically updated.
• add putative RNA(s) from GFF: add new putative RNAs to the list of results. For that, you have to upload a file or paste information in GFF format. . Click on the save button to store the description. The new putative RNAs are inserted in the pool of putative RNAs, and the Explore page is automatically updated.
• merge putative RNAs: merge all selected putative RNAs into a single prediction. The new prediction is built as following:
  • ID: a new ID is created
  • Start: the smallest start value
  • End: the largest end value
  • Strand: + if at least one prediction is +, and others are + or ., - if at least one prediction is - and others are - or ., . otherwise.
  • Family: the concatenation of initial family names separated by '/' (has to be renamed if family name is longer than 20 characters)
  • Software: the concatenation of software names separated by '/' and prefixed by 'Merge:'
• combine putative RNAs: combine selected putative RNAs to reduce redundancy.
  See the section Combine results for a description of the combine procedure.
• delete: delete all selected putative RNAs.

• align: compare selected putative RNAs by building a multiple alignment between them. The multiple alignment is obtained with ClustalW and RNAz (see above).
• view with ApolloRNA (webstart): view selected putative RNAs in a linear visual output with a webstart application (program is run on the client computer) of ApolloRNA [more information on ApolloRNA].
  Note that as the software runs on the user computer, user has to first download the two files (the genomic sequence in FASTA format and the selected putative RNAs in Ensembl GFF format) provided in a ZIP file that need to be unzip. Second, user has to launch ApolloRNA and point the two local files to be loaded in ApolloRNA. Beware that for Apollo users, the local Apollo configuration will be used. In this case, the tiers for putative RNAs will not be colored in green but in light yellow (default color).

• multiFASTA

  >NC_000913-RNA000032| |-|13559|13618
  ACGUGCAGGAUACCGUCAGCAUCGAUAUCGAAGGUAACUUCGAUCUGCGGCAUGCCGCGCG
  >NC_000913-RNA000032| |-|13559|13618
  ACGUGCAGGAUACCGUCAGCAUCGAUAUCGAAGGUAACUUCGAUCUGCGGCAUGCCGCGCG
  ...
            

• GFF

  NC_000913    blast    ncRNA    228758     228817     61.3    +    .     ID=000001 
  NC_000913    blast    ncRNA    228818     228872     61.3    +    .     ID=000002 
  ...
            

• GFF for Apollo Genome Annotation Curation Tool

  Cobalamin_000162	ncRNA	ncRNA	4979	5181	0.0	+	.
  SSU_rRNA_5_000185	ncRNA	ncRNA	8251	9338	0.0	+	.
  ...
            

• CSV (Comma-Separated Values), a very simple format supported by almost all spreadsheets (including Microsoft Excel) and database management systems

  000001;sample;tRNA-Glu;9979;10054;76;+;E.coli;bacteria;Chromosome;tRNAscan-SE;59.8;1;r01
  000002;sample;tRNA-Thr;16995;17070;76;+;E.coli;bacteria;Chromosome;tRNAscan-SE;91.83;0;r01
  ...
            

• RNAML with extensions. RNAML is a standard XML syntax for exchanging RNA information [more information on RNAML]. Extensions are described in the RNAspace development documentation.

ggggcuauagcucagcugggagagcgccugcuuugcacgcaggaggucugcgguucgaucccgcauagcuccacca 
(((((((..((((........)))).(((((.......))))).....(((((........))))))))))))...
      

• ID: identifier, made up of upper and lower case letters, figures and '_' '.' '-' characters. The length must be between 1 and 6 characters.
• family name: made up of upper and lower case letters, figures and '_' '.' '-' characters. The length must be between 1 and 20 characters.
• start position: must range between 1 and the last position of the query sequence.
• end position: must range betwen start+1 and the last position of the query sequence.
• strand: must have a value in '+' (same strand as the input sequence), '-' (reverse strand) and '.' (unknown).